Wuff

skiing: Elite Feet perfecting boots

noreply@blogger.com (skierpage) — Sat, 24 Apr 2010 18:27:00 +0000

The Nordica Dobermans I got 5 years ago at Elite Feet still fit well. The foot crushing soon relaxed into a snug fit. But two problems:

the sloppy Italians used a velcro™ knockoff for the power strap at the topthat simply doesn't velk — the straps break loose while skiing and slide apart when I carry the boots
water gets into the shell and after a few hours of skiing I can feel dampness in the liner

I know Cosmo's Footwerks makes beefy power straps but I wanted to stay with Elite Feet who have adjusted and repaired the boots a few times over the years, always for free. I went in mid-week while Christian was around (Elite Feet is busy with a second shop at Northstar) and he replaced Nordica's joke straps with BOOSTER straps. These have a huge vibration-damping pad in front and a solid metal cam closure that locks in tight.

As for the water intrusion, I used the awesome power of duct tape and it's made some improvement. Nordica inexplicably cut a notch into the shell near the first buckle.

Meanwhile a Shred Betty had some problems angulating and engaging her inside ski's outside edge in her Nordica boots. Legendary instructor Tim Reeve recommended Start Haus to her boots and possible canting. But instead of working with the boots she brought, the boot fitter said they were too loose and tried to put her in Dobermans. Rule 1: if someone tries to put you in a tighter boot, they're showing off their boot-fitting prowess above listening to your needs. Instead, Christian at Elite Feet suggested removing her liners, allowing them to swell up and reverse some of the "packing out" that compresses the liner over the years. He tested her for canting using Elite Feet's complex mechanical rig (much better than a plumb bob from the knee, and shaved her boots down, inserting the special red shims in the photo and planing the boots so they engage with bindings.
I was hoping a gross misalignment would explain my blown turns to the right with my left ski railing instead of engaging a turn, but no such luck; Christian tested me on the rig and I'm true.

music: trying to get artists to let me compensate them

noreply@blogger.com (skierpage) — Sat, 17 Apr 2010 04:50:00 +0000

We should be in a golden age of abundant music creation. Record a song, upload it to iTunes and Amazon music store, blog/FB/tweet about its release, then sit back and collect most of the revenue from purchases by adoring fans. Use the profits to fund next recording. Friction-free commerce, screw the evil record company suits, master your own destiny, mutual exchange of value with fans.

But it isn't happening! Instead artists are fed up with the music business and frustrated by the declining sales of their label releases. The tired refrain from self-justifying music pirates "Artists should make money from merchandise sales and touring" is garbage; I want excellent recordings more than a T-shirt or a hit-or-miss performance that I may not be able to attend.

Whenever I hear about a recording by my heroes, I look to buy it online, but I only find songs from official album releases that I already own, which is frustrating as hell. I'm able to talk with some artists themselves about this, and the semi-conversations are dispiriting. I wind up feeling like I'm hassling them to accept my money.

From Thomas Dolby's blog post about the great set of performances he organized for the TED2010 conference

I usually put together a house band who play a short piece to open each of the 12 sessions over the 4 days of TED... After the four exhausting days of TED were over, we went to a local studio run by an old friend Chuck Mitchell, and recorded our 10 pieces for posterity. We managed to get them all down despite the onset of the familiar post-TED hangover. Perhaps I’ll include them on a TED house band compilation CD one day; and perhaps ‘Pistol’ will go on my album as-is. ...

# skierpage Says:
I don’t get it. You’re talking about some great performances to your fan base, they were obviously recorded during the TED conference, and you’ve even gone and re-recorded some of them. SO WHERE THE ^%$#@! IS THE [Buy Now!] BUTTON?!

C’mon, make some people happy and make a little money! What’s the problem?

# TMDR Says:
Interesting attitude, Skierpage. Believe it or not, the priority at a non-profit event like TED is *not* to make a ton of money from the music. As for the performances, I plan to make some of them available in due course, but I just got home jet-lagged from California and need a rest! And, as you can imagine, it’s not easy to clear copyrights for people like Sheryl Crow and David Byrne, so there’s a risk those may never get heard. A lot happens at TED that you can only experience by being there, but they’ve done a pretty good job of making a lot of the content available to the world for free, with a lot more to come. And, as I mentioned above, there was talk of a compilation CD featuring TED music.

# skierpage Says:
Dear TMDR,
Thank you so much for responding to my crass whingeing. Your performances have value, I long for a system that encourages and rewards you for making them available without it being a grinding chore. It sounds like musicians need to adopt standardized performance copyright clearance language (something concert bootleggers don’t have to mess with), and perhaps a lawyer-mandated USB pinprick accessory on the concert laptop to sign in blood after the performance?

So you know I’m not one of those “I’m not going to pay for music until it comes with a pink pony” liars on the ‘net, I just bought the SXSW version of “The Key to Her Ferrari” from Amazon MP3 Downloads while waiting. Sweet! (BTW, Amazon says “From the Album Alien’s Ate My Buick” — Apostrophes Ate Our Language.)

# TMDR Says:
Actually the point is, this is really nothing to do with the money. I have an album of my own music to finish, and that’s a higher priority than getting the TED intros–which are all cover versions bar one–out to the general public. But I promise some if not all of them will be available at some point, as audio or video or both.

Ouch, how to irritate the creative type with well-meaning exhortation. By the time “available at some point” rolls around, the excitement and interest will have dissipated. Meanwhile I can get immediate gratification from bootlegs and crummy YouTube videos, but the artist earns nothing.

I had a similar exchange with Max Tundra on Facebook:

Max Tundra: I did a cover version of "Digital Love" by Daft Punk, playing all the parts by hand/mouth. Check it out, on this great podcast full of reinterpretations: http://www.cokemachineglow.com/podcast/5145/fantasycovers2010-parttwo
You and 23 others like this.

S Page: You are a lock for Supertramp's next keyboard player! (5:34 on) How can we buy this performance, it's not on Amazon?

Max Tundra: It's not for sale, just grab it for free from the above link - there's a downloadable mp3 of the entire podcast.

S Page: Call me a crazy anachronism, but I like to compensate artists for their fine efforts ;-) Create new work, sell, profit, repeat until we die.

Max Tundra: Nice idea, but it'll never catch on

Sure I could get an audio editor such as Audacity and slice his song out of the podcast, but again the artist earns nothing. It is about the money, because if it doesn't show up artists will stop making quality (expensive) recordings.

I would love to exchange some money for these recordings and many more. Apparently it's not as simple as I make it out to be in my second sentence above. But it should be!

software: slicing up PDFs

noreply@blogger.com (skierpage) — Sun, 11 Apr 2010 23:48:00 +0000

I wanted to combine all the statements that I downloaded for my audit into a single PDF and then exclude all the cover pages plus the pages of boilerplate disclaimer, "how to reconcile your account", etc. PDF is a standard page presentation format, so you would expect there to be software to do this besides paying Adobe $119 for Adobe Acrobat.

There is, but it's the usual onion: a load of crap surrounding a simple idea.

Googling for "split PDF" finds the usual mess of sites and shareware and paid utilities
- So I restrict to "linux split PDF", which points me to pdftk that Sid Shepard wrote in support of his book. But installing that requires 50MB of supporting GCJ packages. It's really cool this runs as a standalone program, but I already have a Java interpreter installed so this approach is 20× bigger and more complicated,
  - So I google some more and find joinPDF, supposedly a simple script and a Java library written by Gerard Briscoe, but the directory to download for this is defunct.
    - There are tons of other search results for this, on Mac shareware sites (someone bundled a graphical user interface for the Mac for users who don't know how to enter command lines), but their links are broken as well. (As an aside, why can't Google be smart? If I Google "download joinPDF" and a page with that text has a broken link, then don't waste my time with that search result!! I need a decision engine, not a search engine.)
      - I finally find a web site that has the simple original joinPDF for download. Follow the README.txt's instructions to manually copy the Java library and two scripts to the right location, and I'm set!
        It turns out the actual core of this onion is a Java library, iText written by Bruno Lowagie, that can slice and dice PDFs: both joinPDF and the bloated pdftk simply include this library and provide a wrapper around it

Now enter the command line
joinPDF combined_statements.pdf checking*.pdf
, and I get combined_statements.pdf! But the files use stupid date naming so they're in the wrong order. Rename them with ISO8601 date format 2007-01, 2007-02, etc. file names, repeat.

Now I have to excise the pages I don't want. joinPDF provides another command, splitPDF, to split a PDF into individual pages, but this does not remove particular ranges of pages. (I should have used splitPDF to split each statement into _page1, _page2, etc. files, then glued a subset of these together, but that seemed to mess up the thumbnail display). I could probably get the source code and write my own simple wrapper around the iText library for an excise command, how hard can Java programming be? But that seems silly. Surely a Portable Document Format should make it easy to cut out pages I don't want.

I bring up combined_statements.pdf in the awesome vim, text editor. It understands PDF files and colorcodes certain words of them: obj, /Type, Kids, stream, etc. Looks promising, but there's no obvious Start of page 39... End of page 39 to chop out. I just need a little guidance as to what these mean. Back to Google for "PDF file format". But all of the articles show graphical tools or describe the format from the bottom up instead of telling me at a high level what to look for. So I add one of the words in the file, endobj to my Google search, and find Introduction to PDF! That's what I need!

For reference, in a particular PDF produced by printing a Quicken document in Wine...

You need to delete the page object and optionally things it references. The PDF is full of flattened objects. Each object starts with NN 0 obj where NN is a number for the object and 0 is its version (0 for most generated objects), and ends with endobj . Delete from one to the other and you've removed an object.

One object in the file is:

2 0 obj
<< /Type /Pages /Kids [ 3 0 R
4 0 R
5 0 R
...
46 0 R
] /Count 44 >>
endobj

This lists all 44 pages in the file, using their object numbers. I think they're in the order you see them, so delete the Nth line inside the brackets and the PDF will no longer have an Nth page. Done! (My PDF viewer Okular doesn't seem to mind that the /Count 44 is no longer accurate.)

You can go on to actually get rid of the page object you removed from the page list:

46 0 obj
<< /Type /Page /Parent 2 0 R
...
/Contents 137 0 R

is the page itself. But that page object is only 12 lines long, where's the actual massive text block with the contents of the page? Well, any time you see NN 0, it's probably a reference to another object; Sure enough, /Contents 137 0 is another object with a huge stream of stuff:

137 0 obj
<< /Length 138 0 R >>
stream
q 0.240000 0 0 0.240000 0 0  cm /R0 gs 0  w 1  J  ... ...

So you can delete this as well. There are more objects you don't need, but they're small enough to leave around.

Update: The joinPDF author's web site actually does exist and you can click through (Software > joinPDF) to his software, but incredibly, Google search results show all those broken links in preference to this! Maybe because he's using frames, but c'mon Google, be smart!

web: it's my data on their web site, let me get at it

noreply@blogger.com (skierpage) — Sun, 11 Apr 2010 22:42:00 +0000

I'm being audited, the IRS says "Please bring cancelled checks and deposit slips", how quaint. It's more like 250+ pages of electronic statements and electronic check images to print out. I wish the IRS let you bring a directory of hyperlinked PDFs.

Fortunately my financial institutions provide online records going back far enough, though one (whose name rhymes with "smells cargo") cuts off after a pathetically short two years.

==> Save your own PDF copies of your statements! Don't rely on your bank.

Unfortunately, all financial institutions make it difficult to grab this information. The URL to download my January 2007 statement is invariably an impenetrable mess. It should be just https://secure.thebank.com/records/internalUserID/2007/statements/checking_1234_2007-01.pdf, where internalUserID is what refers to me internally. Then I can just change the end of the URL to 2007-02, -03, etc. You might think it's more secure to have a meaningless jumbled URL with token IDs and session IDs and crap, but that's confusing a secured session with a complicated name, and it's guaranteeing the URLs will change when they rethink their web site.

(The same really holds true for any other data on the web. I can't get my pictures out of Sprint PictureMail because there isn't a simple URL for each one.)

Also, the institutions do the usual crappy job of naming the downloaded file. When I repeatedly click to download my statements, I get

BANKSTMT_APR2008_1234.pdf BANKSTMT_AUG2008_1234.pdf BANKSTMT_DEC2007_1234.pdf BANKSTMT_DEC2008_1234.pdf BANKSTMT_FEB2008_1234.pdf BANKSTMT_JAN2008_1234.pdf

Note the ^$#@! random order of the files because the institution didn't use ISO8601 date format. BANKSTMT_1234_2008-04.pdf sorts in the right order, why do people persist in using stupid date formats?.

The real interesting issue is what would happen if I was no longer a customer of Tells Margo? The moment you're not a customer, you lose access. But that's not fair, a former customer still should have rights to access old data. Again, that's why simple URLs are so important. An institution should let me access /records/internalUserID/correspondence/2010/some_old_record.pdf even if my accounts are defunct. And again, until the world works as it should, save those records in your own well-organized system despite the hassle.

disintermediation part 1: ordering direct

noreply@blogger.com (skierpage) — Tue, 26 Jan 2010 11:00:00 +0000

I have a backpack from the Gap. It is utter garbage that's falling apart. So what exactly is the Gap adding when it has a Chinese factory sew its label on their part 53AF47Y?

Just let me order the best product direct from its manufacturer.

This applies whether I want a custom one-off or just their generic part. As I wrote (responding to a Gizmodo post triggered by Wired's garbled-rahrar-as-usual story about custom manufacturing about custom manufacturing:

I want the best worker in the factory cranking out quality $10 clothes to make me custom stuff after hours for five times the price (which will still be less than what some US store charges me for their worthless label). That just requires some bilingual entrepreneur to set up a web storefront to take my order and hook me up direct with the manufacturer.

This is a huge potential market. It cuts out the non-existent added value of some dumbass US brand supposedly getting me better quality goods while in reality they're just twisting their suppliers' arms to reduce costs.

Sadly for the USA, this innovation is more likely to come from a Chinese bilingual near the factory rather than someone living in America.

Meanwhile every American brand that only spends on marketing while ordering up generic crap (clothes, luggage, sunglasses, tools, ANYTHING, etc., etc.) from overseas factories DESERVES TO DIE. The actual factory can be the brand, and can offer custom work through these entrepreneurs. The moment Happy Dong Manufacturing gets a great rating from Consumer Reports and you can order its widget on eBay, a lot of USA specialty stores will really suffer.

This is starting to happen on Amazon. Go search for a replacement battery or USB and you'll find some entrepreneur from Asia selling them absurdly cheap.

disintermediation part 2: Amazon should be/buy UPS

noreply@blogger.com (skierpage) — Tue, 26 Jan 2010 10:00:00 +0000

I used to compare items for price using MySimon and Froogle, now I usually go to Amazon and pay whatever they ask. There are still companies competing on price: you can buy LCD TVs from obscure companies in Nebraska that sound like they are operating out of a bedroom, some dot com sites are still trying "shopping innovations" such as buying circles (get 15 friends to buy the same product and it's 5% less), and of course there are people selling new stock on auction sites.

All of these are a waste. A third party coming between the manufacture and me can do no more than jack up the price. My thesis is simple: the lowest possible price of an item is the price at which the manufacture is willing to put it on the loading dock, plus shipping to your door. Everything else is overhead.

You may respond "But shipping 50,000 widgets to Walmart is a lot cheaper than shipping widgets to 50,000 addresses." Sure, but Walmart has its overhead. They have to uncreate 50,000 items and put them on the shelves of big stores, then wait for them to sell.

No manufacturer wants the hassle of shipping to 50,000 customers. But manufacturers don't really want the hassle of shipping even to 100 stores either. The whole process of getting goods to you is called logistics:

Logistics involves the integration of information, transportation, inventory, warehousing, material-handling, and packaging, and occasionally security.

Many manufacturers already outsource this. What's stupid is the manufacturer pays for one logistics chain that gets widgets from it to the store, then the store pays for another chain that gets the widgets to customers' houses.

You could argue that manufacturers need stores to aggregate individual purchases into bulk orders; they can't run their assembly line in response to individual orders dribbling in, but they can intelligently respond to a 50,000 item order from a store. But bulk orders just hide inefficiency and mistakes. Some of a big order winds up on sale or dumped in discounters and outlet stores, which jacks up costs for the store. You could claim that stores should know their customers' tastes better than the manufacturer, e.g. the Super Bowl is coming up but economic conditions are poor so cheap 720p TVs will do well while 1080p will languish; but that's part of the problem: manufacturers need this information as much as stores do! A manufacturer whose customers are big stores knows less than a manufacturer whose customers are the actual users.

For years I've believed the obvious answer is for Amazon (market cap $ 52 bn, revenue $22 bn) to buy or become UPS (market cap $58 bn, revenue $ 45 bn). This results in one chain from the loading dock to the customer! Returning to my thesis, the manufacturer tells UPS/Amazon what price it's willing to put it on the loading dock, and Amazon/UPS puts it in the customer's hands. The manufacturer and Amazon/UPS can work out whether to manufacture 50,000 at once or do smaller runs, it all ends up in one supply chain. And Amazon/UPS has all the customer knowledge and programming smarts to offer sales approaches that reduce prices like bulk-buying circles, limited-time promotions, auctions, reverse auctions, overstock, etc. but in conjunction with the manufacturer.

Anyone know Jeff Bezos' e-mail address?

disintermediation part 3: universal spiff

noreply@blogger.com (skierpage) — Tue, 26 Jan 2010 09:00:00 +0000

Retail stores are struggling because it's cheaper and better to buy things on the web. I see something I want in the store, but I wonder if that model is highly rated, and I know I can get it cheaper online. Yet manufacturers still need to get goods in front of customers in the real world where they can see, touch, and use them in order to make the sale. Some companies have tried manufacturer stores, but they are hampered by not undercutting other stores (my local Sony Style store closed a year ago).

When I worked in tech support, if a support engineer was able to convince a customer that they needed a product (often a paid upgrade to the new version that addressed the problem) , the employee would transfer the phone call to sales and get a small commission on the sale. This is called a “spiff”: A bonus or other remuneration, given for ... promoting the goods of a particular manufacturer.. The problem is if the customer later on bought the product because of that person's assistance, there was no way the employee could get compensated. I've also gone out on sales calls where my technical knowledge sealed the deal, yet the sales person got the commission.

My thesis is companies have a certain promotional budget for the sale of an item, and they should be willing to hand sum over to anyone on ANY sale. They already do this on click-through ads for web sites, but they should extend this to the world of people.

It would work somewhat like this:
Enter the e-mail address of the person who led you to buy this product: __@___

So whether someone demonstrated the laptop at the Sony lifestyle store, or someone showed it to you at a convention, or you saw a book at a bookstore but guiltily purchased it online instead, or your mechanic told you to buy some accessory, or you read a rave review about something on a blog, you can credit the person who led to your purchase.

This would encourage and liberate millions of people to sell things, and it would break down the artificial division between salespeople selling a product and the many people whose efforts can lead to a sale. It would provide a financial model for company "stores" and marketing events that merely demonstrate items yet often spur sales.

Companies probably wouldn't allow any e-mail address, they would have a known list of approved promoters: all their employees, partners, people on certain web sites. The system has vast potential for "abuse", e.g. someone who had nothing to do with the sale would offer to split the spiff with the buyer. But the abuse still leads to increased sales!

non-support: Suddenlink can't help itself

noreply@blogger.com (skierpage) — Tue, 12 Jan 2010 00:31:00 +0000

My cable bill appears on my bank's billpay site, but when I click "View Bill" nothing displays. My bank can't fix it. So first I tried Suddenlink's "Chat now":

S Page: my problem with viewing my Suddenlink statement through my bank's online bill payment system. Can you assist with that?
Dana: Unfortunately, no. We provide the statements to your Suddenlink.net account. ... Viewing it via your bank's online bill pay, could be an issue with their system.
S Page: No, wsc.suddenlink.net is definitely doing something wrong. My bank's billpay site shows all my other electronic bills fine. It presents the amount and date of my Suddenlink bill fine, but when I try to view the Suddenlink bill, a) it only works if I reduce my browser security settings and b) even when I do that I get "JSPG0036E: Failed to find resource /WEB-INF/jsp/lang/en/atl_cferror.jsp".
S Page: This is a highly technical flaw with https://wsc.suddenlink.net/EUR_ViewBill/Controller/ProcessCheckFreeAuthorisation?data=...
Dana: That could still be an issue with their site. Have you been able to view your bills at that site before?
S Page: As I said, *every other electronic bill* I get works fine. Problem a) has been around for over a year, but the error message b) is new.
S Page: Do you have a bug reporting system? I want you to enter in it "Customer reports two problems with wsc.suddenlink.net's presentation of online billing to another billpay system. ..." I would be happy to provide more details but there's no point if you don't have a method to report problems with this system.
Dana: We do not have a method to report this that I am aware of. I can report it in your account.
Dana: Everything that I am finding on that error appears to be software issues so far.
S Page: Well that's completely lame. I'm trying to help Suddenlink fix a problem with a service it provides! Suddenlink must have a director of web software engineering who needs to know that your electronic bill presentation system isn't working. Yes it's a software problem.
Dana: (no response)

I tried again with Melanie on the phone. She also had no means to report that their bill-presenting software is broken, the best she could do is e-mail her supervisor.

It's the same sad pattern as Earthlink support and Symantec support. They can all help a customer with certain classes of problems, but the company is structured to be incapable of letting a customer help them.

The future of the web is supposed to be autonomous bits of software talking to each other on behalf of customers, but dinosaur companies aren't set up to support the interaction.

skiing: mogul love 18 ways

noreply@blogger.com (skierpage) — Sun, 10 Jan 2010 04:56:00 +0000

O mogul field, how do I love thee? Let me count the ways:

classic short radius turn: Approach mogul, plant pole on top, as you crest the mogul the tips and tails of your skis clear the snow, so you can turn both feet simultaneously to swing the skis around in a short-radius turn and slide down the backside of the mogul towards the trough before the next bump. This is how most skiers attempt moguls, but there's more to life.
pivot slip: Turn your feet in-place on the crest so that your skis don't follow the arc of a short turn, instead they pivot within their length and you transition into a pure sideslip. Disadvantage: hard to control.
pop off pillow below: Don't turn so much, so your skis head downhill more than slide sideways. Guide your skis towards the soft snow in front of the next bump while keeping your body low. They'll hit that soft snow, your upper body will pop up and the unweighting will turn your skis the other way. Disadvantage: can be herky-jerky
leaper edge change: Ski diagonally to the bump, let it launch you, in mid-air tilt your shins and ankles to change from your uphill edges to your downhill edges, and land in the trough before the next bump. For bonus points, land past the next bump. Works better in shallower bumps. Disadvantages:needs room, takes guts.
GS turn across two/three/four bumps: Ski over the bump, use the unweighting to effect the edge change, extend your legs to the side but don't twist too much, and make a huge turn across the mogul field as you simply absorb subsequent bumps. Have faith, the power of your turn overwhelms the forces from the bumps. Disadvantage: how strong are you?
two tight turns down the spine: Make a tight turn or a pivot turn at the crest of the bump but rather than slide down its back, make a second turn again on the convex part. If you imagine your skis resting on a sphere, your tips and tails are always clear and ready for another turn. Works best on longer "beached whale" bumps. Disadvantage: it's harder to turn on a downward slope.
hop turn: Instead of a scrabble slide down the back of the bump, just do the entire turn in mid-air. This avoids any worry about your skis clearing the bumps nearby. Pick a suitable landing spot: on the backside, in the trough, in the pillow of soft snow before the next bump, or even on the next bump. Disadvantages: Could be a big drop, your back might hate you.
carve the water line: Don't slide down the backside of the bump, don't slide into the next bump, don't even pivot on the crest. "Simply" follow the 'S' shaped path between the bumps that water would follow down the hill. Retract your legs as the path flattens out, extend them to the side after the path changes direction and curves. Disadvantages: In two turns you'll be going ridiculously fast, sometimes there's no room for a carved turn.
aggressive turn finish uphill: Most people trying to link turns in moguls stop turning when their skis face across the hill, which doesn't reduce speed. As they improve they try to stop turning when their skis point to the start of their next turn, which usually picks up speed. To control your speed, keep turning your skis (whether skidded or carved) until they point uphill; you'll need to practice twisting your knees at the end of turns. (If turning is good, more turning is better!) You can either steer to a bump slightly uphill or skid backwards into the next turn. Keep your upper body facing downhill and the extreme counter-rotation of your upper and lower body builds up big forces; the moment you relax your skis will swing into the next turn. Disadvantages: none.
avalement avec le deep knee bend: "avaler" is French for "to swallow". As you ski to a huge bump, instead of popping off it or launching, crouch low to absorb it. Crouch ridiculously low to look French; when you plant your downhill pole on top of the bump your hand should be above your shoulder! Disadvantage: it's harder to pivot when you're that low.
le jet turn: Instead of pivoting as you crest the bump, shoot your skis forward and turn the tips in front of you. After a stylish drop into the trough, bring your upper body back over your skis Disadvantage: unless you're French, you'll look dopey.
backpedal the feet up the face: Retracting your legs as you ski up the face of a bump picks up speed. It's possible to resist the upward pressure of the rising face to slow down slightly. One way I've heard it described is you move both feet as if backpedaling from bottom to top on a bicycle. As you approach the face of the bump, push your feet forward and let the bump push them upward. Disadvantage: you have very little time to get this right.
push the dolphins back under the water: You can think of this as the reverse of back-pedaling up the face, you're moving both feet to pedal forward and down. But riding dolphins SeaWorld-style is more poetic. You don't want bumps to throw you (unless you want to do leapers or hop turns). After you reach the crest of a bump, you need to aggressively push the tips of your skis down and into the new turn to avoid an unintentional launch. Especially in bumps in new snow, you want to feel as if you're driving your skis back under the water — as if you're astride two dolphins that crest out of the water and then you drive them back under. Disadvantages: none.
punch the gearlever into third: The pole plant on the crest of a bump helps timing and gives you something to twist around. But as you move downhill you don't want that pole plant to hold you back and you definitely don't want it to pull your shoulder back so that your upper body faces across the hill. So reach downhill and plant the pole, but immediately push your hand further downhill in an aggressive move. It should feel as if you're rapidly shifting a car's gear lever from second to third. Watch freestyle skiers, their hands always return to downhill in front of them. Disadvantages: none.
one-and-two independent leg ("Hey, it's slightly better than a stem christie"): You want slightly more weight on the outside leg in any ski turn, and in moguls the outside leg has more room. If you're in a slight snowplough the outside leg is pointing in the direction of the new turn but your inside leg is pointing the wrong way and has less room. and winds up perched on the bump. So you start the turn with the outside leg and simply lift up the inside leg and put it down next to the outside leg. It gets you down the gnarliest bumps. To help avoid this, before you start turning bring your skis closer together and crouch lower. Disadvantages: less fluid, less control at the start of the turn.
skidded parallel turn to out-of-control traverse (oops): Skidding a turn, leaving your pole behind, and not turning your skis all lead to you facing across the hill and bouncing into the steep sides of nearby bumps. Disadvantages: not stylish
sideslip with optional caught edge and shoulder plant (ouch): Nearly all mogul turns involve some skidding, so skip the turn part and just do the skid. Act like a novice snowboarder and sideslip over and down the bumps fast and smoothly. Imagine that you're a 70s skier on 7 foot planks and it'll be another 3 seasons before you can make parallel turns. Disadvantages: by definition in bumps the snow isn't flat, so there may be NO correct edge angle for effortless sideslipping.
And if all else fails, straightline short sections, pumping your legs up and down like Jonny Mosely to absorb the bumps.: Disadvantages: can your knees take the abuse?

Armed with these techniques you can approach a mogul field as artistic goal-driven surgery. Here are some operations:

Descend as slowly as possible yet smoothly, by turning uphill and steering uphill to bumps.
Le French totale, all deliberate lower leg actions and huge knee bends.
Stickwork, punching the gearlevers and planting poles to set your downhill progress.
Maximum absorption, using retraction and extension over and down bumps to increase or reduce speed (I suck at this, in a skateboard halfpipe after pumping the deck five times I wind up motionless at the bottom)
Minimal effort, just directing and pivoting the skis in advance so that as you reach each bump it turns your skis for you.
Stay off the snow, doing leaper and hop turns off every bump instead of absorption
Two monster GS turns to cover the whole thing.
Keep all your turns in a narrow corridor regardless of conditions.

art: Rothko coolly torches SFMOMA

noreply@blogger.com (skierpage) — Sun, 10 Jan 2010 03:26:00 +0000

SFMOMA's Rothko (No. 14, 1960) quietly overpowers everything else in the museum. It's not the Titanic, it's the iceberg that sank the Titanic. It's suffused with pure emotion, but it's a receding internal burn. The red is alive but not fiery; the mouth (or dot of the exclamation point?) underneath is a deep inky blue but it's not heavy, you can see through it to the background of quiet earth. The brushwork is sensationally good. Ten feet tall, it's bigger than you but it's taking emotional states available to everyone and exalting them to a mystical, noble level. Duchamp invented so much, Picasso and Matisse were big stars, but in 2200 I'm confident people will rank Rothko higher than any other artist of the 20th century.

Rothko painted a similar design in 1961's Number 207, it's brighter on darker and blacker. The canvas is burning up:

computers: the heck of Linux audio, the hell of documenting it

noreply@blogger.com (skierpage) — Sun, 27 Dec 2009 21:17:00 +0000

For no apparent reason sound stopped playing in certain applications on my computer.

I'm running the Kubuntu flavor (incorporating the KDE Plasma Desktop) of the Ubuntu distribution of Linux, which makes certain decisions about how sound should be configured. But I've also installed latest Firefox and Thunderbird and the Flash plug-in and the VLC media player; these make their own decisions about how to play sounds. Kubuntu appears to provide an audio "software stack" consisting of the following layers: hardware audio drivers, the ALSA low-level Linux interface to audio, the PulseAudio server to mix audio streams and talk to different hardware, and KDE's Phonon audio abstraction. That's complicated enough, but great minds can and do disagree if this is the best approach to audio; some people think audio should be simpler, some think it should support playing across the network to your Bluetooth headset when you walk into the garden and automatically switch to 5.1 surround sound if you login to your friend's home PC. Those disagreements result in multiple software packages and approaches to audio. So somehow some piece of software additionally installed the GStreamer multimedia framework and the esound daemon on my computer. And each of these layers can be configured to talk to, bypass, or emulate the other layers, so maybe I have an emulation of OSS or JACK or some other software approach. Each program tries to detect what's available and use the right approach, but each program and layer can be configured to use different layers. Who knows where the problem is? Who knows what the right solution is?

Each one of these programs and packages has sound-related documentation. But each doesn't know how my system is configured, so their instructions are inadequate, incomplete, or wrong.

So I search for "ubuntu sound problems". One of the results is "Comprehensive Sound Problem Solutions Guide", even though it was written in 2006! And it has 1,680 follow-up comments! Another search result confidently instructs you to remove the PulseAudio sound engine altogether, even though it's what Kubuntu uses. Another tells you how to compile source programs to add sound support, even though Kubuntu came with dozens of sound packages and other programs have installed many more. Most instructions tell you to make unexplained undocumented changes to configuration files, even though there are configuration dialog boxes in Kubuntu and it attempts to configure itself correctly without these files.

The documentation is spread everywhere; Google rewards the oldest most out-of-date information; reasonable people don't agree on how it should work. I'm probably screwed. If and when I figure out how to fix my problem I would love to improve the "Linux sound documentation", but in what form (bug report, forum post, wiki page, web page, built-in help) for which component or layer or distribution? Agggggghh.

art: the lonnnngg view, the evolved sense

noreply@blogger.com (skierpage) — Sat, 17 Oct 2009 07:23:00 +0000

Judtih Thurman's New Yorker piece on cave art is inspiring. What were our ancestors thinking 32,000 years ago when they drew animals on the walls by torchlight? Their art affects us so profoundly; does that mean they are close kin to us that we can inhabit in our imaginations, or does art transcend species and culture so we're safer admitting those strangers in the dark are incomprehensible? What does it say about art that five times more than recorded history later, no artist draws animals better?

Meanwhile, Denis Dutton wrote a New Yorker op-ed piece dubious about conceptual art, invented by grand old man Duchamp a mere 90 years ago. He mentions the 32,000 year history of representational drawing, and 100,000 years of decorative shell necklaces, but they're passing fads: he points out our ancestors showed off for 1,200,000 years by crafting attractive Acheulian hand axes. "Ooh, nice symmetrical chipping surfaces, let's mate."

It's interesting, but fails to make a case. So appreciation of skill has been around for 1.4 million years and we've only refined our aesthetic sensibility recently? That is no evidence that we'll regress to a more conservative primitive "if it ain't skilled, it's crap!" form of art appreciation. He says

Jokes about Cadillac tailfins and early fax machines were once amusing, and the same can be said of conceptual works like Piero Manzoni’s 1962 declaration that Earth was his art work, Joseph Kosuth’s 1965 “One and Three Chairs” (a chair, a photo of the chair and a definition of “chair”) or Mr. Hirst’s medicine cabinets. Future generations, no longer engaged by our art “concepts” and unable to divine any special skill or emotional expression in the work, may lose interest in it as a medium for financial speculation and relegate it to the realm of historical curiosity.

But I've never heard of those 1960s pieces —I'm already the future generation—and they sound beguiling and intriguing. One and Three Chairs is excellent! Meanwhile mere skill in the Renaissance religious painting (or in sexy hand axe tip chipping) leaves me lukewarm.

Back to cave paintings, they've inspired other fine art: Here's William Gibson speaking on the cave paintings as the precursor to movies, and Steely Dan's The Caves of Altamira lyrics.

skiing: Shane McConkey

noreply@blogger.com (skierpage) — Mon, 12 Oct 2009 03:37:00 +0000

Tonight's CBS 60 Minutes had a great segment on wingsuit jumps off mountains (watch it). At 8:15 JT Holmes reminisces about his friend, skiing icon Shane McConkey. Shane died last year when he couldn't release his skis in time — he was combining skiing and wingsuit flying just as he earlier combined skiing and BASE jumping. Fly like a bird, about 1 in 400 risk of dying doing what you love.

The only ski movie I own is
there's something about McConkey:

From ridiculously exposed mountain goat descents to Alaskan peak straightlines, from full-twisting switch backflips in the terrain park to double backflips off cliffs, from building base jumps to swinging on helicopter skids, from rock skiing to stream skiing to the inebriated shenanigans of Saucerboy, ...
The film focuses on the abilities, attitudes and antics that have made McConkey a hero for a generation

Indeed when he died, messages boards were split between "He died doing what he loves, he's my hero" and "He had a wife and kid, unlike a fireman he risked his life for nothing, he's no hero", which shows “hero” has both the Greek ideal for-the-greater-good and an ironic worshipping-false-gods meaning.

After that movie he tried skiing on waterskis which led to his invention the first reverse camber ski, the Volant Spatula, followed by the K2 Pontoon and now a whole category of reverse camber and rocker skis.

cars: death of American brands

noreply@blogger.com (skierpage) — Sat, 10 Oct 2009 00:15:00 +0000

I'm surprised how my friends didn't care about General Motors going under. Making things is important to a country's soul, and the alternative of financial shenanigans didn't work out well.

GM has survived, but at the cost of so many storied nameplates. It's hard to keep track of the carnage, here's where things stand, with a little help from Wikipedia.

Hummer: Its sale to Sichuan Tengzhong Heavy Industrial Machinery Company blocked by Chinese government on "environmental grounds" in June, but in October it finally went through for $150 million (a baseball stadium costs three times as much). GM has no plans to continue the nameplate after the 2010 model year.

Opel/Vauxhall: Sold! To consortium lead by Magna Group-backed-by-Sberbank of Russia (55%). GM will continue to own 35% of Opel; while Opel employees will own 10%. Called "New GM Europe" by some.

Pontiac: dropped, all of its remaining models will be phased out by the end of 2010.

Saab: A deal to sell it to tiny Swedish supercar maker Koenigseggeggegegg (sp?) is supposedly still on, though it depends on three billion Swedish Kronor appearing from the tooth fairy troll.

Saturn: Dead now.

GM holds on to Chevrolet, Buick (mostly for China), Cadillac, and GMC trucks and SUVs.

Damn that's depressing. It mirrors the fall of British Leyland.

religion: why Sharia law is a bad idea

noreply@blogger.com (skierpage) — Tue, 25 Aug 2009 21:40:00 +0000

From the New Yorker piece about Pakistan strife, discussing the human rights lawyer Asma Jahingar:

A woman named Samia Sarwar, from Peshawar, who wanted a divorce from her abusive husband, was hiding from her family in the H.R.C.’s shelter. Under Jahangir’s guidance, Sarwar agreed to discuss the situation with her mother. But the mother showed up at Jahangir’s office with a hired assassin posing as her driver. As the two entered the office, the assassin shot Sarwar in the head. The assassin was killed by a policeman as he attempted to flee the building. Yet Sarwar’s mother was never charged with being an accomplice to murder. Following the strictures of Sharia, the heirs of the victim—in this case the abandoned husband and the two children—exercised their right to forgive the murderer. It was a graphic illustration of the way that Sharia can be twisted to legalize the murder of women deemed to have “shamed” their families.

From the BBC:

An Afghan bill allowing a husband to starve his wife if she refuses to have sex becomes law.

I can hear the apologists now: Islam is a religion of peace, it's being twisted by extremists, lots of bad things happen in "the West", yadda yadda, blah blah. Whatever. I read about the outcomes in Muslim countries, and they're sickening.

house: bamboo floor, panels, slat

noreply@blogger.com (skierpage) — Wed, 29 Jul 2009 23:13:00 +0000

People ask about the bamboo panels on our second floor.Here's a view of the kitchen and pantry towards the front of the house. The column holds up the roof, the horizontal bar keeps the walls from caving in.

We wanted a connected feel (we've never lived in a place where the floors are divided), so Markoff-Fullerton Architects carved a slot connecting the floors. Also the "nose" at the front of the house is a double-height space. The normal modern architect way to block these gaps off while retaining an airy open feel would be with metal cabling, but the widths are so narrow the mounting hardware would overwhelm the cables. So we had to introduce a new material into the house palette. Fossil Faux Studios had a resin panel with bamboo in it, which echoes the Plyboo flooring throughout the second floor. Saw it into three panels; done.

Fossil Faux can put anything in resin, like the Cocteau Twins' Four-Calendar Café album cover.

Building code trivia: you're required to have power outlets every 10 feet, so the low wall of the slot has them even though they are ugly and unneeded.

The nose gets a lot of sun, so we bought a hanging fabric slat from Inhabit; you can see it hanging above the three panels. The print is of grass not bamboo, but matches pretty well. What I'd really like is to make the same overlapping pattern in strips of solar photovoltaics, and you could adjust them to either block more light (and thus make more energy) or to let light through in the winter.

I wish Photoshop Elements could do perspective correction as well as simple image straightening!

TV, computers: the future of video

noreply@blogger.com (skierpage) — Sat, 25 Jul 2009 00:51:00 +0000

I've got some big video files I want to watch on my TV: a Joanna Newsom concert, the Chinese Olympics opening ceremony I struggled to download, and the banned Karen Carpenter biopic made with Barbie dolls.

I could buy a 16GB USB flash drive, copy the files, and stick it in the Samsung TV. But the Samsung supports very few (if any?) video formats.
Instead, the storage device holding the video files could output TV. LG actually makes such a device, the LG XF1, a 500 GB hard drive with HDMI out. It even comes with a remote.
I could transfer the files to my Playstation 3 which is permanently hooked up to the TV.
I could try turning one of our computers into a media server that the Playstation can access.
I could cart my laptop over to the TV and plug it in.

If you give the storage device drive an LCD display, then it replaces the portable DVD player. Portable Media Players like the iPod do this; with a base station they can output to a TV.

My understanding is that Apple's system still revolves around managing files on your computer in iTunes. But if the video file storage device has a display you can expose its computer ability and let the thing do its own downloading and file management. You can even plug it a USB TV tuner so that it can replace the VCR.

The question is whether these mini video file players will be a PMP, a smartphone, or a tiny netbook. Maybe all three will bloom. If it needs a dock to connect to your TV then you'll want a remote control, which is strange now that remotes are like touchscreen phones.

It sounds like Nvidia is thinking this way with their Tegra chip set, which only consumes a few watts even when decoding and outputting HD video. Since it doesn't run Intel's x86 instruction set it won't run desktop Windows. You'd think that makes it the perfect candidate for a micro netbook running Linux, but instead Microsoft's Zune HD is going to use it, and so maybe as a result Nvidia isn't promoting Linux on it.

The device I'm envisioning has been around for a while in the Archos series of "heavy-duty" portable media players. They offer a cradle with HDMI out, and even a remote with keyboard to drive the touch-screen device from across the room, yet they've had little success. Maybe I'm missing something.

architecture: Louis Kahn's Salk Institute: absence of grandeur yet completely inspiring

noreply@blogger.com (skierpage) — Sun, 19 Jul 2009 01:46:00 +0000

Architectural tourism is somewhat clichéd, “You simply must visit Bilbao to see the Guggenheim” Nevertheless it is the reason to see Chicago, and reading a trip to Philip Johnson's Glass House (actually a 47-acre site full of buildings by the near-master) made my mouth water. So on a road trip to La Jolla I remembered the Salk Institute by mid-century modernist Louis Kahn, and we wandered around for 35 minutes.

Here's the iconic plaza (click each image to see larger)

I cropped it off-center so you can see the primitive offices, made out of teak wood and slatted windows. They feel more like a kitchen window in a beach house, but that's what was available in 1960. Kahn said of his design "Materials used are concrete, wood, marble and water."

The stream drops down a level to a pool, revealing more of the Pacific coast landscape
It's just geometric form, but the tranquil perfection fills your heart.

The pool flows down another level
Looking back, you see the offices in those solid towers oriented towards the Pacific. And people were sitting on those beautiful Platonic forms.

The towers you see on the plaza are for professors' offices, they are flanked by towers for laboratories and utilities, (read more at the Salk site.) Since the plaza is high up, the towers actually extend several floors below it to form these lovely cloisters. Much of the new architecture at Oxford University tries to achieve this feel, but doesn't have this amazing topography.

The institute has grown, so further inland from that intitial fountain, Anshen + Allen (who worked with Kahn) designed an additional building to the east split by a symmetrical path up to the plaza. Here's one side of it.

It's good, it uses the same forms with the same lowered courtyards, and can use "modern" glass and cladding, but it lacks the gentle heft of the original.

The institute was on the World Monuments Fund 2008 list of the 100 most endangered sites because of a planned 240,000 square foot expansion, plopping a daycare center in that iconic view of the Pacific, but it seems the institute has come up with a more acceptable plan.

Fonts on the Web are cool.

noreply@blogger.com (skierpage) — Fri, 17 Jul 2009 00:03:00 +0000

Dang, doesn't work in Blogger, go see separate test.

Or, I meant to say these Fonts on the Web are cool.

Good browsers support custom fonts. That header should look bizarre yet somewhat attractive. If you're using Microsft Internet Explorer (the big blue 'e') then you won't, so upgrade today. I used Fonts on the web site to make the compressed font that just has a few letter.

Besides the big incompetent blue browser impeding progress, the other problem with fonts on the web is the serious font foundries won't sell their fonts so you can refer to them from your web site, unless you pay tens of thousands of dollars. People point out that this means the serious font foundries will just watch free and pirated fonts take over this new market.

What's depressing is all the haters who attack the craftspeople who make beautiful fonts, for example one dope writes "Because, at the end of the day, you draw letters. How much did you *think* people were going to pay for that?" Fonts are no more and no less than a beautiful, optional tool for portraying written ideas. I used to be involved in technical publications and spent time looking at fonts and had the Adobe PostScript font posters on the wall, and I write my e-mails in plain ASCII text. Some of the ideas on this web site would be more compelling in a beautiful font.

how can genes possibly do all they do?

noreply@blogger.com (skierpage) — Mon, 06 Jul 2009 23:32:00 +0000

There are a little over 3 billion base pairs of DNA in the human genome. The four possibilities for each one (A C G T) can be encoded in two bits, so that's 750 Megabytes of information, and the genome has lots of common sequences and repeating sections so you can compress it down a lot. It amounts to as much data as there is on a music CD, far less than on a DVD. That is completely ridiculous!

Those genes not only lay out the biochemistry of individual cells, they also are blueprints for the physical arrangement of our bodies. When you go to a doctor's office and see the pink medical illustrations of something like your eye or intestine or ear, and notice that every single nook and layer has a name, somehow your genes result in that structure, and thousands upon thousands of other structures in your body. Just the CAD program for the shape of the bones in your inner ear would take up many megabytes. The design and operating manual for the eye would be thousands of pages. You could accept this if each cell had specialized blueprints, but every one of 10 trillion cells in your body carries the identical DNA. How can one compact set of instructions make tens of thousands of complicated parts!!

But wait, there's more. The same genome also codes for innate behaviors. Bees dancing in a certain way. My dog biting the ankle to herd cattle. The staple of popular magazine thought: males who fool around perpetuate their DNA better so their cheatin' genes win. And the mother of all behaviors, human language. Now this would be plausible if humans had a monster additional section appended to our genome, an extra hundred million DNA pairs for altruism and brain development and tool-building and grammar and so on, but the chimpanzee genome is 95% identical to the human genome. No way!!!

This overloading is insane. It must mean that the genetic tweak to have, say, a tendency to Asperger's must also affect lower-level things, and that not all variations are possible, and that the command & control explanation of the genome "the DNA says build this way, operate this way, develop this way, behave this way" must be insufficient. I tried to put this absurdity to gene fan Matt Ridley at a talk, but he brushed it off, he maintains it's all in the genes. But in our DNA there are only "20,000–25,000 protein-coding genes, far fewer than had been expected before its sequencing. In fact, only about 1.5% of the genome codes for proteins," Huh??!

A long time ago I went to an Ask a Scientist talk by Dr. Terrence Deacon. It was dizzyingly complex and hard to follow, but he acknowledged the essential craziness. Instead of throwing up his hands and expressing disbelief as I'm doing, he (and presumably other scientists) reasons out what the mismatch between a CD's worth of information and the outcome must imply.

Very roughly speaking, our DNA can't possibly code for this complexity and yet the tiny differences in our DNA resulted in it. Therefore the complexity has to be emergent somehow. There has to be some interplay with the environment that emerges over time, at every level — with the chemistry in the cell, with the differentiating cells nearby, with the other synapses in the brain, with the other animals in the group, and now in humans, with language. As we evolve, these external factors co-evolve with us, and the system as a whole reliably produces the complexity. Some of those ideas are presented in this interview. Heady stuff, but it seems undeniable. Meanwhile, you can go to Ensembl.org and walk the genome of various animals; here are the first million base pairs on chromosome 1 in us, export as text to get the CCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTA goodness.

computers: Linux update (I'm stuck with it)

noreply@blogger.com (skierpage) — Wed, 01 Jul 2009 04:21:00 +0000

I trashed my Windows partition — long story, still haven't given up — so I'm typing this in Firefox in the Kubuntu (K Desktop Environment on Linux) free software I fortunately had installed earlier. Sound still screeches, but apart from that I don't really notice, since I found 64-bit nightly Firefox builds.

KDE is just a nice panel strip and Kickoff menu below my browser windows ;-). (And someday, the promise of KDE's Nepomuk/Strigi/whatever semantic technologies, should Kubuntu ever deign to turn it on and explain it to me.)

Apparently Firefox integrates better with other Linux distributions, so maybe I shouldn't have used this one.

music: Michael Jackson RIP

noreply@blogger.com (skierpage) — Tue, 30 Jun 2009 22:48:00 +0000

I'm listening to Off the Wall, which David Gates in Newsweek rightly identifies: "it came out the year he turned 21, and it was his greatest purely musical moment". I remember hearing the title track with Michael Jackson's yelp and crazed giggles, now so fun to parody, and being stunned by the vocal chances he was taking. Don't Stop 'til You Get Enough is effervescent, wonderful disco with a killer opening and a fantastic percussion lead-out, then Rock with You has impeccable singing over sensational bass by Louis Johnson (of the Brothers Johnson), and a confident lush groove.

Quincy Jones deserves so much of the credit for this record and Thriller. Jackson's best songs were written by Rod Temperton (formerly of Heatwave), but his own songs are fine: the aforementioned Don't Stop 'til You Get Enough, Beat It, Billie Jean, etc. Two of the biggest and best pop records ever made are from Michael Jackson, and all the weirdness and tawdry sickness of his personal life (read Maureen Orth's features in Vanity Fair, but you'll want to bathe afterwards) can't take that away.

TV: what to do with old videotapes?

noreply@blogger.com (skierpage) — Sun, 14 Jun 2009 01:43:00 +0000

With the digital TV transition, my VCR became a boat anchor for recording broadcast television. What, if anything, should I do with all the VHS tapes on the media shelves? I reckon Star Trek: The Next Generation will come out one day on a handful of Blu-ray disks or a single memory chip. Many of the classic bits of broadcast TV are on YouTube, if not I should upload them myself. As with digitizing vinyl if I'm going to do the job I want to do it with quality. The aging PC on which I type this has an ATI All-in-Wonder 9800 Pro card with video-in capability, but it lacks the supposed key feature for quality analog TV digitization, timebase correction.

Also, I've been meaning to give a spare VCR away, this transition makes it even more worthless tech. Another one of spage's laws:

If you don't freecycle something the day you stop using it, it'll be worthless when you finally get around to disposing it.

TV: what replaces the VCR?

noreply@blogger.com (skierpage) — Sat, 13 Jun 2009 23:12:00 +0000

I thought I was set for last night's digital TV transition, I've been watching free digital TV over-the-air for a while. Then I realized... the VCR!!? No more sticking a tape in 5 minutes before you leave in order to record some must-see TV, only to find you overwrote the middle of the Lawrence Welk PBS special after the funny Andy Rooney rant, and then trying to pencil in a meaningful update to the table of contents on the two tape labels and the box to remind you of the random bits of video on the tape worth keeping.

I wonder how many others will be in the same situation? I guess I could get a DTV converter box only for use with the VCR, but tape is so last-century. Once demodulated, the HD signal is fully digital (it's just MPEG-2 1s and 0s), so turning it back into high-frequency modulation of magnetic particles on squeaky spools of plastic film coated with rust seems completely unnecessary. My Samsung LCD TV already has a USB port to read video files from a USB flash drive, it seems it would be a simple software upgrade for it to write video files to USB.

I guess two years ago when electronic companies were planning today's TVs, the bandwidth of HDTV seemed so massive that it would flood any storage device. The digital broadcast TV data rate is 19.4 Mbit/s, which means a 1-hour show fills 8.7 Gigabytes. But nowadays that's half a $25 16GB USB drive. And I think most broadcast "channels" squeeze several digital channels into that bandwidth, so the real rate is less.

As with all other media, the digitization of TV means any small rectangular box with computer chips can now work with video, and indeed cameras, computers, phones, and videogame consoles all do. (The future of video is a bigger discussion than the VCR replacement...) The tuning of over-the-air broadcasts has become the province of digital TV capture "cards" for computers such as the Pinnacle PCTV HD Pro stick; plug an antenna into it, plug it into a PC's USB slot, and watch or record broadcast TV. But that means dedicating a computer computer to recording TV programs, something I tried without success with my desktop. The capture card is already a computer, it could just write the 1s and 0s to an attached USB flash drive without requiring a PC. You would need some simple interface (it couldn't be worse than the VCR's flashing "12:00" UI) to tell the capture card to record a show. You could have a keypad and LCD phone-like UI on the capture card to program it; or the capture card could show its UI on the TV screen, but that would require plugging it into an HDMI input on your TV in addition to the USB slot. Either way it's getting fiddly again.

music: John Mayer, an appreciation

noreply@blogger.com (skierpage) — Thu, 11 Jun 2009 01:51:00 +0000

There are a lot of people out there who know John Mayer only as the Jennifer Aniston-bonking teen heartthrob behind the awful "Your Body is a Wonderland" Let the scales fall from your eyes!
Years ago I caught the video of No Such Thing 1½ times and couldn't get it out of my head. In 20 seconds you can tell he knows how to assemble a quality song. When you hear him sing the fabulously wrong "Uhhhp my sleeve" you hear the musicianship.

So I bought the album "Room for Squares". Massive disappointment. After "No Such Thing", it seems just a generic series of singer-songwriter melancholic songs, with the genuinely bad "Your Body is a Wonderland" as a nadir. A massive let-down, maybe he sold his soul to the devil for that one song.

Then on his next record "Heavier Things" he's thanking Buddy Guy and Elton John, like all the bands on MySpace, and people slam it for its horrible Loudness War sound.

But...

The songs on "Room for Squares" all grow on you:
- Neon has a surprisingly tricky chords
- 83 is sweet
- 3x5 is a really strong lyric about living life instead of trying to capture it
- He tosses in a dead stop acoustic freakout in the midst of Your Body is a Wonderland performances (at 1:20)
I caught the TV special of him playing with Buddy Guy, and damn, his blues playing is right there. (I still don't understand the Elton John connection.)
"Heavier Things" is an album of expansion and growth in song-writing. Clarity is an outstanding song despite the awful sound.

Then he releases "Try!" by the John Mayer Trio and blows the doors off, from the very first song onwards. He's channeling Hendrix and Stevie Ray Vaughn. Great stuff, though the sound is hurt by drummer Steve Jordan producing it and over-boosting his snare.

"Continuum" is a bit of an anticlimax, just a set of good pop songs.

All links are YouTube videos unless otherwise indicated. Every performance is subtly different and has its merits. I love John Mayer Trio - Chicken Grease / Jam / Cissy Strut for a lonnng jam. You'd never believe this guy is a pop star in People magazine all the time.