house: bamboo floor, panels, slat

People ask about the bamboo panels on our second floor.Here's a view of the kitchen and pantry towards the front of the house. The column holds up the roof, the horizontal bar keeps the walls from caving in.

We wanted a connected feel (we've never lived in a place where the floors are divided), so Markoff-Fullerton Architects carved a slot connecting the floors. Also the "nose" at the front of the house is a double-height space. The normal modern architect way to block these gaps off while retaining an airy open feel would be with metal cabling, but the widths are so narrow the mounting hardware would overwhelm the cables. So we had to introduce a new material into the house palette. Fossil Faux Studios had a resin panel with bamboo in it, which echoes the Plyboo flooring throughout the second floor. Saw it into three panels; done.


Fossil Faux can put anything in resin, like the Cocteau Twins' Four-Calendar Café album cover.

Building code trivia: you're required to have power outlets every 10 feet, so the low wall of the slot has them even though they are ugly and unneeded.

The nose gets a lot of sun, so we bought a hanging fabric slat from Inhabit; you can see it hanging above the three panels. The print is of grass not bamboo, but matches pretty well. What I'd really like is to make the same overlapping pattern in strips of solar photovoltaics, and you could adjust them to either block more light (and thus make more energy) or to let light through in the winter.

I wish Photoshop Elements could do perspective correction as well as simple image straightening!

TV, computers: the future of video

I've got some big video files I want to watch on my TV: a Joanna Newsom concert, the Chinese Olympics opening ceremony I struggled to download, and the banned Karen Carpenter biopic made with Barbie dolls.

• I could buy a 16GB USB flash drive, copy the files, and stick it in the Samsung TV. But the Samsung supports very few (if any?) video formats.
• Instead, the storage device holding the video files could output TV. LG actually makes such a device, the LG XF1, a 500 GB hard drive with HDMI out. It even comes with a remote.
• I could transfer the files to my Playstation 3 which is permanently hooked up to the TV.
• I could try turning one of our computers into a media server that the Playstation can access.
• I could cart my laptop over to the TV and plug it in.

If you give the storage device drive an LCD display, then it replaces the portable DVD player. Portable Media Players like the iPod do this; with a base station they can output to a TV.

My understanding is that Apple's system still revolves around managing files on your computer in iTunes. But if the video file storage device has a display you can expose its computer ability and let the thing do its own downloading and file management. You can even plug it a USB TV tuner so that it can replace the VCR.

The question is whether these mini video file players will be a PMP, a smartphone, or a tiny netbook. Maybe all three will bloom. If it needs a dock to connect to your TV then you'll want a remote control, which is strange now that remotes are like touchscreen phones.

It sounds like Nvidia is thinking this way with their Tegra chip set, which only consumes a few watts even when decoding and outputting HD video. Since it doesn't run Intel's x86 instruction set it won't run desktop Windows. You'd think that makes it the perfect candidate for a micro netbook running Linux, but instead Microsoft's Zune HD is going to use it, and so maybe as a result Nvidia isn't promoting Linux on it.

The device I'm envisioning has been around for a while in the Archos series of "heavy-duty" portable media players. They offer a cradle with HDMI out, and even a remote with keyboard to drive the touch-screen device from across the room, yet they've had little success. Maybe I'm missing something.

architecture: Louis Kahn's Salk Institute: absence of grandeur yet completely inspiring

Architectural tourism is somewhat clichéd, “You simply must visit Bilbao to see the Guggenheim” Nevertheless it is the reason to see Chicago, and reading a trip to Philip Johnson's Glass House (actually a 47-acre site full of buildings by the near-master) made my mouth water. So on a road trip to La Jolla I remembered the Salk Institute by mid-century modernist Louis Kahn, and we wandered around for 35 minutes.

Here's the iconic plaza (click each image to see larger)

I cropped it off-center so you can see the primitive offices, made out of teak wood and slatted windows. They feel more like a kitchen window in a beach house, but that's what was available in 1960. Kahn said of his design "Materials used are concrete, wood, marble and water."

The stream drops down a level to a pool, revealing more of the Pacific coast landscape
It's just geometric form, but the tranquil perfection fills your heart.

The pool flows down another level
Looking back, you see the offices in those solid towers oriented towards the Pacific. And people were sitting on those beautiful Platonic forms.

The towers you see on the plaza are for professors' offices, they are flanked by towers for laboratories and utilities, (read more at the Salk site.) Since the plaza is high up, the towers actually extend several floors below it to form these lovely cloisters. Much of the new architecture at Oxford University tries to achieve this feel, but doesn't have this amazing topography.

The institute has grown, so further inland from that intitial fountain, Anshen + Allen (who worked with Kahn) designed an additional building to the east split by a symmetrical path up to the plaza. Here's one side of it.

It's good, it uses the same forms with the same lowered courtyards, and can use "modern" glass and cladding, but it lacks the gentle heft of the original.

The institute was on the World Monuments Fund 2008 list of the 100 most endangered sites because of a planned 240,000 square foot expansion, plopping a daycare center in that iconic view of the Pacific, but it seems the institute has come up with a more acceptable plan.

Fonts on the Web are cool.

Dang, doesn't work in Blogger, go see separate test.


Or, I meant to say these Fonts on the Web are cool.

Good browsers support custom fonts. That header should look bizarre yet somewhat attractive. If you're using Microsft Internet Explorer (the big blue 'e') then you won't, so upgrade today. I used Fonts on the web site to make the compressed font that just has a few letter.

Besides the big incompetent blue browser impeding progress, the other problem with fonts on the web is the serious font foundries won't sell their fonts so you can refer to them from your web site, unless you pay tens of thousands of dollars. People point out that this means the serious font foundries will just watch free and pirated fonts take over this new market.

What's depressing is all the haters who attack the craftspeople who make beautiful fonts, for example one dope writes "Because, at the end of the day, you draw letters. How much did you *think* people were going to pay for that?" Fonts are no more and no less than a beautiful, optional tool for portraying written ideas. I used to be involved in technical publications and spent time looking at fonts and had the Adobe PostScript font posters on the wall, and I write my e-mails in plain ASCII text. Some of the ideas on this web site would be more compelling in a beautiful font.

how can genes possibly do all they do?

There are a little over 3 billion base pairs of DNA in the human genome. The four possibilities for each one (A C G T) can be encoded in two bits, so that's 750 Megabytes of information, and the genome has lots of common sequences and repeating sections so you can compress it down a lot. It amounts to as much data as there is on a music CD, far less than on a DVD. That is completely ridiculous!

Those genes not only lay out the biochemistry of individual cells, they also are blueprints for the physical arrangement of our bodies. When you go to a doctor's office and see the pink medical illustrations of something like your eye or intestine or ear, and notice that every single nook and layer has a name, somehow your genes result in that structure, and thousands upon thousands of other structures in your body. Just the CAD program for the shape of the bones in your inner ear would take up many megabytes. The design and operating manual for the eye would be thousands of pages. You could accept this if each cell had specialized blueprints, but every one of 10 trillion cells in your body carries the identical DNA. How can one compact set of instructions make tens of thousands of complicated parts!!

But wait, there's more. The same genome also codes for innate behaviors. Bees dancing in a certain way. My dog biting the ankle to herd cattle. The staple of popular magazine thought: males who fool around perpetuate their DNA better so their cheatin' genes win. And the mother of all behaviors, human language. Now this would be plausible if humans had a monster additional section appended to our genome, an extra hundred million DNA pairs for altruism and brain development and tool-building and grammar and so on, but the chimpanzee genome is 95% identical to the human genome. No way!!!

This overloading is insane. It must mean that the genetic tweak to have, say, a tendency to Asperger's must also affect lower-level things, and that not all variations are possible, and that the command & control explanation of the genome "the DNA says build this way, operate this way, develop this way, behave this way" must be insufficient. I tried to put this absurdity to gene fan Matt Ridley at a talk, but he brushed it off, he maintains it's all in the genes. But in our DNA there are only "20,000–25,000 protein-coding genes, far fewer than had been expected before its sequencing. In fact, only about 1.5% of the genome codes for proteins," Huh??!

A long time ago I went to an Ask a Scientist talk by Dr. Terrence Deacon. It was dizzyingly complex and hard to follow, but he acknowledged the essential craziness. Instead of throwing up his hands and expressing disbelief as I'm doing, he (and presumably other scientists) reasons out what the mismatch between a CD's worth of information and the outcome must imply.

Very roughly speaking, our DNA can't possibly code for this complexity and yet the tiny differences in our DNA resulted in it. Therefore the complexity has to be emergent somehow. There has to be some interplay with the environment that emerges over time, at every level — with the chemistry in the cell, with the differentiating cells nearby, with the other synapses in the brain, with the other animals in the group, and now in humans, with language. As we evolve, these external factors co-evolve with us, and the system as a whole reliably produces the complexity. Some of those ideas are presented in this interview. Heady stuff, but it seems undeniable. Meanwhile, you can go to Ensembl.org and walk the genome of various animals; here are the first million base pairs on chromosome 1 in us, export as text to get the CCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTA goodness.